Электронный научный журнал

ГЕРОНТОЛОГИЯ
«GERONTOLOGY» Scientific Journal

БИОГЕРОНТОЛОГИЯ

SUBFAMILY OF FGF19, FGF21, FGF23 FIBROBLASTS GROWTH FACTORS AS FACTORS OF

Khavinson V.Kh.1,2, Kuznik B.I.3,4, Linkova N.S.1,5, Sall T.S.1, Orlova O.A.1
1. Saint-Petersburg Institute of Bioregulation and Gerontology, St. Petersburg
2. Pavlov Institute of Physiology of RAS, St.-Petersburg
3. Chita State Medical Academy, Chita
4. Innovation Clinic “Health Academy”, Chita
5. Peter the Great Saint Petersburg Polytechnic University, St. Petersburg
Full file PDF (180 Kb)
УДК 612.67, 577

Известно, что FGF19, FGF21 и FGF23 образуют уникальное подсемейство факторов роста фибробластов, содержащих внутримолекулярные дисульфидные связи, снижающие сродство к гепаран-сульфату, расположенному во внеклеточном пространстве. В отличии от других факторов роста фибробластов, FGF19, FGF21, FGF23 действуют как эндокринные гормоны [15]. FGF23 и его ко-рецептор α-Klotho, являющийся ключевым фактором, поддерживающим гомеостаз уровня кальция и фосфата в организме [13], принимает участие в борьбе со старением [15]. Установлено, что уровень растворимого в плазме крови α-Klotho с возрастом резко уменьшается, а гиперэкспрессия соответствующего гена ассоциируется с повышенным риском заболеваний, связанных с возрастом [11].

За последние годы показано, что FGF19 является фактором, препятствующим процессу старения. В частности, установлено, что FGF19 защищает печень от действия токсических веществ. При хронических заболеваниях печени содержание FGF19 в крови уменьшается.  Более того, снижение уровня FGF19 способствует прогрессированию ишемической болезни сердца, а также способствует более тяжелому течению сахарного диабета 2 типа [9, 14].

Важную роль в замедлении процесса старения играет FGF21, являющийся одним из основных эндогенных регуляторов метаболизма липидов и глюкозы. Путем воздействия на FGF21 можно добиться существенных достижений в лечении таких заболеваний, как диабет и метаболический синдром. Известно, что стареющие нейроны более уязвимы к токсическому действию глутамата. При этом комбинированная терапия литием и вальпроевой кислотой вызывает синергичные протективные эффекты. Оказалась, что при такой терапии в нейронах мозга крыс значительно повышалась экспрессия мРНК FGF21. Комбинация гликоген-синтазы-киназы GSK-3 (glycogen synthase kinase-3) с вальпроевой кислотой или ингибитором деацетилазы гистонов (histone deacetylase, HDAC) с литием повышают уровень мРНК FGF21. В то же время экзогенный белок FGF21 полностью защищал стареющие нейроны от глутамата [12].

Не меньшее значение в антистарении принадлежит фактору FGF23, функция которого тесно связана с его ко-рецептором α-Klotho, препятствующего развитию ассоциированных с возрастом и хронических заболеваний через регуляцию метаболизма витамина Д [10]. Так, концентрация в сыворотке крови секреторной формы Klotho (sKlotho) отрицательно коррелирует с возрастом и содержанием FGF23 и резко уменьшается у пациентов с остеопорозом [11].

В связи с этим важным представляется поиск биологически активных веществ, способных эпигенетически регулировать экспрессию геропротекторных белков FGF19, FGF21 и FGF23. К таким регуляторным молекулам можно отнести геропротекторные пептиды – KE, KED, AEDG. Все перечисленные пептиды обладают не только выраженным геропротекторным действием, но способны воздействовать на иммунитет, сердечно-сосудистую систему и стимулировать когнитивные функции [2-7]. Ранее было высказано предположение, что пептиды KE, KED, AEDG способны взаимодействовать с сайтами связывания в промоторах белков "молодости" - мышечного гормона ирисина, являющегося регулятором длины теломер, и фактора роста GDF11, стимулирующего пролиферацию нейронов в различных образованиях центральной нервной системы у животных и людей при старении [1]. Кроме того, пептид KED в экспериментальных моделях на животных и культуре клеток стимулирует процессы пролиферации эндотелия и фибробластов [3, 6]. Пептид KE способствует заживлению ран у крыс в эксперименте [3]. Пептид AEDG, синтезированный на основе аминокислотного анализа полипептидного комплекса эпифиза, в экспериментах в культурах клеток и на животных обладает антиоксидантной активностью, регулирует синтез мелатонина, обладает иммуностимулирующими свойствами, способствует увеличению длины теломер в нормальных фибробластах и преодолению лимита Хейфклика [7]. Пептид AEDG в концентрациях 0,05- 2,00 нг/мл на 29-45% повышал пролиферацию органотипических культур ткани кожи молодых и старых крыс Wistar. Стимуляция пролиферации фибробластов кожи под действием пептидов составила в культурах клеток кожи молодых и старых животных [6].

Все эти свойства пептидов KE, KED, AEDG позволяют предположить, что они могут оказывать геропротекторный эффект в отношении фибробластов кожи, возможно, через активацию факторов роста фибробластов, в том числе FGF19, FGF21, FGF23.

Ранее методом молекулярного моделирования было показано, что для пептида KED сайтом связывания является последовательность азотистых оснований ДНКCCTGCC, а также обратная ей последовательность CCGTCC, для пептида КЕ – GCAG и ее обратная последовательностьGACG, для пептида AEDG – ATTTCи обратная последовательностьCTTTA[4, 5]. Для изучения сайтов связывания пептидов KE, KED, AEDG были использованы данные нуклеотидной последовательности промоторной зоны генов FGF19, FGF21 и FGF23. Промоторные участки перечисленных генов человека и мыши были обнаружены с использованием поисковой системы Eukaryotic Promoter Database [8]. Полученные данные представлены в таблицах 1 и 2.

Таблица 1.

Возможные сайты связывания для пептидов KE, KED, AEDG в промоторных участках генов FGF19, FGF21 и FGF23 человека (Homosapiens)

Ген

Регуляторный участок гена, range -499 to 100 bp (кДНК 5'→3')

GenBank №

FGF19

TGACGTCAGATGTGCGGGGCTGCGAAAGTCGGGGGAGGGAGTGCGAGTGGGCTTTTAAGGGGAAGGGCACTAAGGCCGAGGTGAGGCTTTTCCCGACAGAGGGTGAAGGGGGCAAAACTCGGTGCCCCCCAACCTCTGGCCCCGGGGTTCCTGACCCCGCCCCCGCTAGTGCCCCACGCCGAGTGCATCCACTGGGAGCCTGAGGCCTGGGGGAAGGGCCCCAGTTGTCGATTGCTTTACAAAGTCAAACTCTCCCAGCCAAGAACCTCGGGGCCGCTGCGCGGTGGGGAGGAGTTCCCCGAAACCCGGCCGCTAAGCGAGGCCTCCTCCTCCCGCAGATCCGAACGGCCTGGGCGGGGTCACCCCGGCTGGGACAAGAAGCCGCCGCCTGCCTGCCCGGGCCCGGGGAGGGGGCTGGGGCTGGGGCCGGAGGCGGGGTGTGAGTGGGTGTGTGCGGGGGGCGGAGGCTTGATGCAATCCCGATAAGAAATGCTCGGGTGTCTTGGGCACCTACCCGTGGGGCCCGTAAGGCGCTACTATATAAGGCTGCCGGCCCGGAGCCGCCGCGCCGTCAGAGCAGGAGCGCTGCGTCCAGGATCT

NM_005117.2

 

FGF21

CACCCACGAGTCCAGATCCCTAGCCCCTACTCCCTCAGACCCAGGAGTCCAGACCAAAGCTCCCTCCTCCCTCAGACCCAGGAGCCCAAGTTCCCCAGCCCCTCCTCCCTCAGATCCAGGAGTACAGGCCCAGACCCTCCTCCCTCAGACCCAGGAGTCCAGGCCCCCCACCCCTCCTCCCTCAGACCCAGGAGTCCAGAGCCCCAGCCCTCCTCCCTCAGACACAGAAGGCCTACCCTTGCACCCTTAGGGGCTCCAGGAAATTAGCCAACCTGTCTTCCCTCTGGGTGCCCACTCCAGGGCCTGGCTTGGCTGCCAACTCCAGTCAGGGACTTTCAGCCACCCCTCCCCCCAGGTTATTTCAGGAGCACCTGCCTGGGCCTGGGATGGCTTCTCTGGTGAAAGAAACACCAGGATTGCATCAGGGAGGAGGAGGCTGGGATGTCCAGGGTCTGAGCATCTGAGCAGGGACAGATGAGGTTGAGGTTGGCCCACGGCCAGGTGAGAGGCTTCCAAGGCAGGATACTTGTGTCTCAGATGCGGTCGCTTCTTTCATACAGCAATTGCCGCCTTGCTGAGGATCAAGGAACCTCAGTGTCA

NM_019113.3

FGF23

CGGCAAAAAGGAGGGAATCCAGTCTAGGATCCTCACACCAGCTACTTGCAAGGGAGAAGGAAAAGGCCAGTAAGGCCTGGGCCAGGAGAGTCCCGACAGGAGTGTCAGGTTTCAATCTCAGCACCAGCCACTCAGAGCAGGGCACGATGTTGGGGGCCCGCCTCAGGCTCTGGGTCTGTGCCTTGTGCAGCGTCTGCAGCATGAGCGTCCTCAGAGCCTATCCCAATGCCTCCCCACTGCTCGGCTCCAGCTGGGGTGGCCTGATCCACCTGTACACAGCCACAGCCAGGAACAGCTACCACCTGCAGATCCACAAGAATGGCCATGTGGATGGCGCACCCCATCAGACCATCTACAGTGCCCTGATGATCAGATCAGAGGATGCTGGCTTTGTGGTGATTACAGGTGTGATGAGCAGAAGATACCTCTGCATGGATTTCAGAGGCAACATTTTTGGATCACACTATTTCGACCCGGAGAACTGCAGGTTCCAACACCAGACGCTGGAAAACGGGTACGACGTCTACCACTCTCCTCAGTATCACTTCCTGGTCAGTCTGGGCCGGGCGAAGAGAGCCTTCCTGCCAGGCATGAACCCACCCCCGTACTC

NM_020638.2

 

Таблица 2.

Возможные сайты связывания для пептидов KE, KED, AEDG в промоторных участках генов FGF19, FGF21 и FGF23 мыши (Musmusculus)

 

Ген

Регуляторный участок гена, range -120 to 100 bp (кДНК 5'→3')

GenBank №

FGF19

CTGTCGGAGCAGTAACTCTGTGCGCCCCACGCCACAAGCGCCCAGTTGCTTTGTGGGTTGTGCCTGCCCTGCGCCTGCAACTTGAGTCCCCGCCGCATCGCAGTCTCCGCGCCACCTTTGTAACGGCCTTCAGGACCCCGAGGTGTCATGGCGAGAAAGTGGAACGGGCGTGCGGTGGCCCGAGCCCTGGTCCTGGCCACTCTGTGGCTGGCTGTGTCTG

NM_008003.2

FGF21

AGACAGCCTTAGTGTCTTCTCAGCTGGGGATTCAACACAGGAGAAACAGCCATTCACTTTGCCTGAGCCCCAGTCTGAACCTGACCCATCCCTGCTGGGCACCGGAGTCAGAACACAATTCCAGCTGCCTTGGCTCCTCAGCCGCTCGCTTGCCAGGGGCTCTCCCGAACGGAGCGCAGCCCTGATGGAATGGATGAGATCTAGAGTTGGGACCCTGGGA

NM_020013.4

FGF23

GAATCTAGCCCAGGATCCCCACCTCAGTTCTCAGCTTCTTCCTAGGAAGAAGAGAAAGGCCAGCAAGGGCCCAGCCTGTCTGGGAGTGTCAGATTTCAAACTCAGCATTAGCCACTCAGTGCTGTGCAATGCTAGGGACCTGCCTTAGACTCCTGGTGGGCGTGCTCTGCACTGTCTGCAGCTTGGGCACTGCTAGAGCCTATCCGGACACTTCCCCATT

NM_022657.4

 

Примечание к таблицам 1 и 2: жирным курсивом выделены сайты связывания для пептида KED; нижним подчеркиванием выделены сайты связывания для пептида КЕ; жирным шрифтом выделены сайты связывания для пептида AEDG. В правой графе указан номер гена в базе данных GenBank.

Как видно из приведенных данных в промоторе гена FGF19H. sapiens находится 3 сайта связывания для пептида KE, представленные последовательностями GCAG и GACG, 1 сайт связывания для KED в виде последовательности CCTGCC и 1 сайт связывания CTTTA для пептида AEDG (табл. 1). В промоторе гена FGF19M. musculus находится 2 сайта связывания для пептида KE, представленные последовательностью GCAG и 1 сайт связывания для KED в виде последовательности CCTGCC (табл. 2).

Анализ промоторного участка гена FGF21 H. sapiens указывает на наличие 2 сайтов связывания для пептида KE в виде последовательности GCAG, 1 сайта связывания CCTGCC для пептида KED и 1 сайта связывания ATTTC для пептида AEDG. В промоторной области гена FGF21 M. musculus найден 1 сайт связывания для пептида KE, представленный последовательностью GCAG.

Для промоторного участка гена FGF23 H. sapiens обнаружено 8 сайтов связывания для пептида KE, представленных последовательностями GCAG и GACG, 1 сайт связывания CCTGCC для пептида KED и 2 сайта связывания ATTTC для пептида AEDG. Ген FGF23 M. musculus содержит в своем промоторе по 1 сайту связывания для каждого из пептидов KE, KED, AEDG в виде последовательностей GCAG, CCTGCC и ATTTC.

 Как видно из представленных данных, в промоторах гонов человека и мыши имеются сайты связывания для всех трех изучаемых нами пептидов Представленные нами данные позволяют предполагать, что геропротекторное действие пептидов KE, KED, AEDG может быть обусловлено эпигенетическим воздействием на экспрессию так называемых белков "молодости", в том числе и суперсемейства  FGF19, FGF21 и FGF23 и открывает новые перспективы изучения влияния пептидов на факторы роста фибробластов, имеющее большое фундаментальное и практическое значение для молекулярной геронтологии, косметологии и регенеративной медицины. 

Список литературы

  1. Хавинсон В.Х., Кузник Б.И., Тарновская С.И. и др. // Бюлл. эксп. биол. и мед. - 2015. - Т. 160, № 9. - С. 332-334.

  2. Хавинсон В.Х., Кузник Б.И., Тарновская С.И. и др. // Успехи современной биологии. - 2015. - № 4. - С. 370-379.

  3. Хавинсон В.Х., Линькова Н.С., Тарновская С.И. и др. // Бюлл. эксп. биол. и мед.  - 2014. - № 1. - С. 89–93.

  4. Хавинсон В.Х., Тарновская С.И., Линькова Н.С. и др. // Успехи геронтологии. - 2014. - Т. 27, № 1. - С. 108-114.

  5. Хавинсон В.Х., Тарновская С.И., Линькова Н.С. и др. // Бюлл. эксп. биол. и мед.  - 2012. - № 9. - С. 391–396.

  6. Чалисова Н.И., Линькова Н.С., Жекалов А.Н. и др. // Успехи геронтологии. - 2014. - Т. 27, № 4. - С. 699–703.

  7. Anisimov V.N., Khavinson V.Kh. // Biogerontology. - 2010. - № 11. - P. 139-149.

  8. Benson D.A., Karsch-Mizrachi I., Lipman D.J. et al. 2009. GenBank. Nucleic Acids Research. 37 (Database issue). D26–31. doi:10.1093/nar/gkn723.

  9. Itoh N., Ohta H., Konishi M. // Front Endocrinol (Lausanne). - 2015. - Vol. 6. - P. 154-159.

  10. Kim J.H., Hwang K.H., Park K.S. et al. // J Lifestyle Med. - 2015. - Vol. 5, № 1. - P. 1-6.

  11. Koyama D., Sato Y., Aizawa M. et al. Soluble αKlotho as a candidate for the biomarker of aging // Biochem Biophys Res Commun. - 2015. - Vol. 67, № 4. - P. 1019-25.

  12. Leng Y., Wang Z., Tsai L.K. et al. // Mol Psychiatry. 2014. doi: 10.1038/mp.2013.192. Epub ahead of print.

  13. Nabeshima Y. // Proc Jpn Acad Ser B Phys Biol Sci. - 2009. - Vol. 85, № 3. - P. 125-141.

  14. Roesch S.L., Styer A.M., Wood G.C. et al. // PLoS One. 2015. 10:e0116928.10.1371/ journal.pone. 0116928.

  15. Wu X., Li Y. // Aging (Albany NY). - 2009. - Vol. 1, № 12. - P. 1023-1027.

Keywords fibroblasts grow factors, short peptides, aging, pathology.

Full file PDF
Khavinson V.Kh., Kuznik B.I., Linkova N.S., Sall T.S., Orlova O.A., SUBFAMILY OF FGF19, FGF21, FGF23 FIBROBLASTS GROWTH FACTORS AS FACTORS OF // «GERONTOLOGY» Scientific Journal. - 2017. - №2;
URL: http://gerontology.su/magazines?textEn=256 (date of access: 13.04.2024).

Code to embed on your website or blog:

Article views:
Today 2 | Week 3 | Total: 4150